Bioinformatics Converter
Convert between various bioinformatics formats instantly
Paste Data
Upload File
Conversion output will appear here...
Was this tool helpful?
Our GenBank to FASTA Converter is a seamless web-based utility designed for molecular biologists and bioinformaticians. It efficiently transforms annotated GenBank files into the simplified FASTA format by extracting the essential sequence data and its primary identifier.

This conversion strips away detailed feature tables, source information, and other metadata, producing a clean sequence file that is ideal for downstream applications, such as sequence alignment, database searching with BLAST, phylogenetic analysis, and gene expression studies. The tool streamlines your data preparation workflow, enabling you to move from sequence retrieval to analysis quickly and accurately.
How to use (step-by-step)
Follow these simple steps to convert your file in seconds.
- Upload Your File: Click “Upload File” or drag and drop your
.gbor.gbkfile directly into the designated area. You can also paste the file’s content using the “Paste Data” option. - Verify Your Formats: The tool is pre-configured for this conversion. Ensure
GenBankis selected as the input format andFASTAas the output format. - Start the Conversion: Press the “Convert File” button to begin the process. The tool will process your file instantly.
- Download Your File: Once the conversion is complete, a download link for your new
.fastaor.fafile will appear. Click it to save the file to your device.
Tip: If you encounter an error during conversion, check the Troubleshooting Guide below—common causes and fixes are listed.
Input, Output, and Key Changes
Understanding the transformation from a detailed GenBank record to a streamlined FASTA sequence is key to effective bioinformatics analysis. Here’s a breakdown of the formats and the changes that occur.
Sample Input (GenBank Format)
The GenBank format is the standard for submitting and storing nucleotide sequence data from the National Center for Biotechnology Information (NCBI). It is a feature-rich format containing a header with metadata (like locus name, definition, and accession number), a feature table describing genes and protein products, and the raw sequence itself.
Example of a GenBank file:
LOCUS AF086833 434 bp DNA linear VRL 15-DEC-2000
DEFINITION Hepatitis B virus isolate g122, complete genome.
ACCESSION AF086833
SOURCE Hepatitis B virus
ORGANISM Hepatitis B virus
FEATURES Location/Qualifiers
source 1..434
ORIGIN
1 ggaaccacaa ggtcttgcag tgggaaggct gaacattact ggaacagtaa tggtactcag
//
Sample Output (FASTA Format)
The FASTA format is a text-based format representing nucleotide or peptide sequences. It consists of a single-line description (header), followed by lines of sequence data. Its simplicity makes it a universal standard for sequence analysis software.
Example of the same record after conversion:
>AF086833.1 Hepatitis B virus isolate g122, complete genome.
GGAACCACAAGGTCTTGCAGTGGGAAGGCTGAACATTACTGGAACAGTAATGGTACTCAG
Key Changes in the Conversion Process
The conversion from GenBank to FASTA is a simplification process focused on extracting the core sequence data.
- Header Creation: A new FASTA header line (starting with “>”) is generated. This header is typically created using information from the
ACCESSIONandDEFINITIONlines of the GenBank file to ensure the sequence remains identifiable. - Annotation Removal: All detailed annotations are discarded. This includes the entire
FEATUREStable,SOURCE,ORGANISM,REFERENCE, and other metadata fields, as they are not compatible with the FASTA format. - Sequence Extraction and Formatting: The raw nucleotide or amino acid sequence from the
ORIGINsection is extracted, and any non-sequence characters (like numbers and spaces) are removed. The sequence is then typically formatted into lines of a standard length (e.g., 60 characters).
Compatible Software
The generated FASTA files are ready to be used with a wide array of leading bioinformatics software, including:
- BLAST (Basic Local Alignment Search Tool)
- Clustal Omega / ClustalW
- MAFFT (Multiple Alignment using Fast Fourier Transform)
- MEGA (Molecular Evolutionary Genetics Analysis)
- UGENE
- Jalview
Troubleshooting Guide
Encountering an error can be frustrating, but most issues are easy to fix. Here are the most common problems you might face and how to resolve them.
General Tool Errors
Error: “File size exceeds the limit.”
- Why it happens: Your uploaded file is larger than the maximum allowed size. Our server has this limit to ensure quick processing for all users.
- How to fix: For very large genomic records, consider splitting the GenBank file into smaller files (e.g., by chromosome or contig). For processing larger files or to inquire about unlimited usage, please contact us for custom solutions.
Error: “Processing timed out.”
- Why it happens: The conversion of your file is taking too long. This can occur with exceptionally large files containing many individual records.
- How to fix: Try to simplify your input file by breaking it into multiple smaller files. If the issue persists, please contact us to discuss options for handling larger computations.
Error: “CAPTCHA validation failed.”
- Why it happens: Our system uses a CAPTCHA to prevent automated bots. This error occurs if the CAPTCHA was not solved correctly or timed out.
- How to fix: Simply reload the page and solve the new CAPTCHA. If you continue to have trouble after reloading, please get in touch with our support team.
Conversion-Specific Errors
These errors typically relate to the formatting and integrity of your GenBank file.
Error: “Invalid GenBank Format” or “Failed to Parse File”
- Why it happens: The input file does not conform to the strict GenBank flatfile format. This can be due to missing essential tags (like
LOCUS,ORIGIN) or a missing record terminator (//) at the end of the file. - How to fix: Open the file in a text editor. Verify that it begins with a
LOCUStag and ends with//on a new line. If converting multiple records in one file, ensure each record ends with//. Re-downloading the file from the source database (e.g., NCBI) often resolves formatting issues.
Error: “Could Not Parse Multiple Records”
- Why it happens: The file appears to contain multiple GenBank entries concatenated together, but the required
//delimiter between each entry is missing. The parser reads this as one large, corrupted record. - How to fix: Manually edit the file to insert a line containing only
//between each distinct GenBank record.
Error: “Invalid Characters in Sequence”
- Why it happens: The sequence data in the
ORIGINblock contains ambiguous or non-standard characters that are not part of the standard IUPAC nucleotide or amino acid alphabet. - How to fix: Review the
ORIGINsection of your file. Remove any typos or invalid characters. If ambiguous characters (like ‘N’ for nucleotides) are intended, ensure they are compatible with your downstream analysis software.
If your problem isn’t listed here, we want to know about it! Please help us improve the tool by reporting the issue.
Support Our Work
We are committed to keeping our scientific tools free and accessible for everyone. If this tool has been helpful in your work, please consider supporting our mission with a donation. Your support directly helps us cover server costs and fund the development of new, powerful tools for the scientific community.
FAQ
References & Suggested Reading
This tool was developed in line with established principles in bioinformatics for accurate and reliable results. The resources listed below are foundational research and key papers that define these standards, and we highly recommend them for a deeper understanding of the scientific principles involved.
- Benson, D. A., Cavanaugh, M., Clark, K., Karsch-Mizrachi, I., Ostell, J., Pruitt, K. D., & Sayers, E. W. (2018). GenBank. Nucleic Acids Research, 46(D1), D41–D47. https://doi.org/10.1093/nar/gkx1024
- Pearson, W. R., & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences of the United States of America, 85(8), 2444–2448. https://doi.org/10.1073/pnas.85.8.2444
- Cock, P. J. A., Antao, T., Chang, J. T., Chapman, B. A., Cox, C. J., Dalke, A., Friedberg, I., Hamelryck, T., Kauff, F., Wilczynski, B., & de Hoon, M. J. L. (2009). Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics, 25(11), 1422–1423. https://doi.org/10.1093/bioinformatics/btp163
- Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), 403–410. https://doi.org/10.1016/S0022-2836(05)80360-2
- Sievers, F., & Higgins, D. G. (2018). Clustal Omega for making accurate alignments of many protein sequences. Protein Science, 27(1), 135–145. https://doi.org/10.1002/pro.3290