FASTA to EMBL Converter

The FASTA to EMBL Converter lets you convert sequence data from FASTA to EMBL format efficiently. This tool allows rapid conversion of DNA, RNA, or protein sequences into ENA-compliant records.

How to use

1. Upload Your File: Click “Upload File” or drag and drop your file into the designated area. Alternatively, use the “Paste Data” option to paste the file contents for processing.
2. Choose Your Formats: Use the “Input Format” and “Output Format” dropdown menus to specify the desired conversion. Ensure that FASTA (Fast-A) is selected as the input and EMBL (European Molecular Biology Laboratory format) as the output.
3. Start the Conversion: Click the “Convert File” button to initiate the process. The tool will parse your sequence data and generate the corresponding EMBL structure immediately.
4. Download Your File: After the conversion is complete, a download link for the new file will appear. Click the link to save the EMBL file to your device.

How the Conversion Works

The conversion process uses a specialized parsing framework that converts the attributes of a simple sequence record into the complex, line-based schema of an EMBL flat file. This involves extracting the identifier and description from the FASTA header and assigning them to the ID (Identification) and DE (Description) lines, respectively.

The engine calculates sequence parameters such as total base count and molecular composition to populate the SQ (Sequence) header. Whereas a FASTA record contains a single-line description followed by raw data, the EMBL format organizes information into distinct blocks separated by “XX” spacers and concluded with a double slash (“//”). This transformation ensures that the resulting file meets the strict indentation and coordinate-tracking standards required by European molecular biology suites.

Conversion Example

The following example illustrates how a raw FASTA sequence is restructured into a valid EMBL record during the conversion process:

Input (FASTA Format):

>NC_001422.1 pXp (Linear DNA)
ATGCGTACGTTAGCTAGCTAGCTAGCGTACGTAGCTAGCTAGCTAGCGTACGT

Output (EMBL Format):

ID   NC_001422; SV 1; linear; genomic DNA; STD; PRO; 53 BP.
XX
AC   NC_001422;
XX
DE   pXp (Linear DNA)
XX
SQ   Sequence 53 BP; 13 A; 14 C; 14 G; 12 T; 0 other;
     atgcgtacgt tagctagcta gctagcgtac gtagctagct agctagcgta cgt          53
//

Common Conversion Errors

• Invalid Characters in Sequence: The parser expects standard IUPAC codes. If your sequence contains numerical values, special symbols, or non-biological characters, the conversion will be halted to prevent data corruption.
• Malformed Header Lines: FASTA records must begin with the > symbol. If this character is missing or if there are multiple empty lines between records, the engine may fail to identify the sequence start.
• Ambiguous Molecule Type: EMBL files require a defined molecule type (e.g., DNA, RNA, or Protein). If the input sequence is ambiguous or extremely short, the engine may require manual clarification to generate the correct ID line.
• Empty Input: Uploading a file with a valid header but no sequence data will result in a parsing error, as EMBL requires a valid SQ block.

Support Our Work

We are committed to offering free, high-quality computational tools for scientists everywhere. Keeping these resources available and adding new features takes time and resources. If the FASTA to EMBL Converter has helped your research or made your work easier, please consider supporting us.

Donate to our mission: Support ScienceCodons

Reference

The computational logic used for this conversion adheres to the standards established by the following academic resource:

Cock, P. J. A., Antao, T., Chang, J. T., Chapman, B. A., Cox, C. J., Dalke, A., Friedberg, I., Hamelryck, T., Kauff, F., Wilczynski, B., & de Hoon, M. J. L. (2009). Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics, 25(11), 1422–1423. biopython.org/