Bio-Tools

EMBL to FASTA Converter

Bioinformatics Converter

Convert between various bioinformatics formats instantly

Paste Data

Upload File

Drag & drop your file here
or
No file selected
60s remaining
Output
Conversion output will appear here...

Was this tool helpful?

Thanks for your feedback 😍

Used this tool in your research?

Cite it instantly and export to BibTeX, EndNote, RIS, and more.

Generate Citation

Our EMBL to FASTA Converter is a specialized bioinformatics tool that streamlines the transition between sequence data formats. The EMBL format, developed by the European Molecular Biology Laboratory, is a flat-file format containing extensive metadata, including sequence annotations, feature tables, and literature references. Converting these files to FASTA lets users remove complex administrative headers and focus on the primary nucleotide or amino acid sequence data. This simplification is essential for high-throughput computational workflows such as sequence alignment, phylogenetic analysis, and molecular docking, where standard Pearson format files are the preferred input for most processing engines.

EMBL to FASTA Converter

How to use

  1. Upload Your File: Click “Upload File” or drag and drop your EMBL file directly into the designated area. You can also paste the file’s content using the “Paste Data” option.
  2. Choose Your Formats: Use the “Input Format” and “Output Format” dropdown menus to select the conversion you need. Make sure EMBL (European Molecular Biology Laboratory) format is selected as the input and FASTA (Pearson) format as the output.
  3. Start the Conversion: Press the “Convert File” button to begin the process. The tool will process your file instantly.
  4. Download Your File: Once the conversion is complete, a download link for your new FASTA file will appear. Click it to save the file to your device.

Key Changes & Logic of Conversion

The conversion from EMBL to FASTA involves a selective extraction process that prioritizes sequence integrity over metadata retention. During processing, the engine identifies the specific lines in the EMBL flat file to construct a valid FASTA entry.

EMBL to FASTA

The primary logic follows these transformations:

  • Header Generation: The tool parses the ID (Identification) and DE (Description) lines from the EMBL record to create the FASTA definition line, which begins with the > symbol.
  • Sequence Extraction: The sequence data located between the SQ (Sequence header) and the terminal // (Entry terminator) is isolated.
  • Data Cleaning: Numerical values, white spaces, and line breaks found within the EMBL sequence block are removed to produce a continuous string of characters.
  • Information Loss: Please note that qualitative metadata—such as feature table annotations (FT), reference citations (RN, RA, RT), and taxonomic information (OC, OS)—is discarded to adhere to the minimalist structure of the FASTA format.

EMBL to FASTA Conversion Example

This example demonstrates the transition from a metadata-rich EMBL flat file to a streamlined, process-ready FASTA sequence.

1. Input: EMBL Format (.embl)

The EMBL format contains specific line identifiers (ID, AC, DE, SQ) and ends with a double-slash terminator. Notice the extensive metadata and the numbered, spaced sequence at the bottom.

ID   U00096; SV 1; linear; DNA; STD; PRO; 4639675 BP.
XX
AC   U00096;
XX
DE   Escherichia coli K-12 MG1655 complete genome.
XX
KW   Complete genome.
XX
OS   Escherichia coli K-12
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC   Enterobacteriaceae; Escherichia.
XX
RN   [1]
RP   1-4639675
RA   Blattner F.R., Plunkett G. III, Bloch C.A., Perna N.T., Burland V.;
RT   "The complete genome sequence of Escherichia coli K-12";
RL   Science 277(5331):1453-1462(1997).
XX
FH   Key             Location/Qualifiers
FT   source          1..4639675
FT                   /organism="Escherichia coli K-12"
FT                   /strain="MG1655"
FT                   /db_xref="taxon:511145"
FT   gene            190..255
FT                   /gene="thrL"
FT                   /locus_tag="b0001"
XX
SQ   Sequence 66 BP; 15 A; 18 C; 20 G; 13 T; 0 other;
     agcttttatt ctactggtca gcaagctatt gctcgcggat cgctcgcttt ctaccttgtt    60
     catatc                                                               66
//

2. Output: FASTA Format (.fasta)

After processing through the converter, the output is minimalist. Only the primary identifier and description are kept in the header, and the sequence is cleaned of all numbers and spaces.

>U00096 Escherichia coli K-12 MG1655 complete genome.
AGCTTTTATTCTACTGGTCAGCAAGCTATTGCTCGCGGATCGCTCGCTTTCTACCTTGTT
CATATC

Data Privacy & Security

We take the security and privacy of your scientific data seriously. All files are processed using secure, encrypted connections. Uploaded files are handled temporarily and are not stored on our servers. After your session ends or you finish downloading, the temporary data is deleted. We do not claim ownership of your sequences, so your research stays private and protected.

Support Our Work

We aim to offer free, high-quality tools to scientists worldwide. If this converter helps your research or studies, please share it with others. Your feedback helps us improve and add new features. If you have any issues or suggestions, let us know.

References

  • Pearson, W. R., & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences, 85(8), 2444-2448.
  • Cock, P. J., Antao, T., Chang, J. T., Chapman, B. A., Cox, C. J., Dalke, A., … & de Hoon, M. J. (2009). Biopython: Freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics, 25(11), 1422-1423.
  • Stoesser, G., Baker, W., van den Broek, A., Camon, E., Garcia-Pastor, M., Kanz, C., … & Vaughan, R. (2002). The EMBL Nucleotide Sequence Database. Nucleic Acids Research, 30(1), 19-26.

Meet the Authors

Mahdi Morshedi Yekta

Mahdi Morshedi Yekta

Founder & Bioinformatics Developer

Mahdi is the founder of ScienceCodons and a Medical Biotechnologist with a deep passion for computational biology. Holding an M.Sc. in Medical Biotechnology, he specializes in transforming complex biological algorithms into accessible, high-performance web tools, bridging the gap between laboratory sciences and software engineering.

Fatemeh Faryadras

Fatemeh Faryadras

Medical Biotechnologist & Researcher

Fatemeh is a Medical Biotechnologist and researcher. With extensive expertise in genetic engineering, molecular cloning, and cancer biology, she combines her rigorous laboratory background with intuitive design principles to create reliable, user-centered scientific calculators and tools.