Phylip File Format Converter

Our PHYLIP File Format Converter is a flexible web-based utility that reformats your multiple sequence alignments for broad compatibility across different bioinformatics platforms. This tool efficiently converts alignments from the compact phylip format into more widely used formats such as fasta, nexus, or clustal. This process unlocks your data, allowing you to seamlessly move from one analytical or visualization software to another without worrying about format incompatibility. Whether you need a simple fasta file for sequence database searching or a structured nexus file for advanced phylogenetics, this converter streamlines your data preparation workflow.

How to use (step-by-step)

Follow these simple steps to convert your file in seconds.

1. Upload Your File: Click “Upload File” or drag and drop your phylip file directly into the designated area. You can also paste the file’s content using the “Paste Data” option.
2. Choose Your Output Format: Use the “Output Format” dropdown menu to select your desired format, such as fasta, nexus, or clustal.
3. Start the Conversion: Press the “Convert File” button to begin the process. The tool will process your file instantly.
4. Download Your File: Once the conversion is complete, a download link for your new file will appear. Click it to save the file to your device.

Tip: If you see an error during conversion, check the Troubleshooting Guide below—common causes and fixes are listed.

Understanding the Conversion Process

Converting your phylip file involves a complete syntactical transformation. Here’s a breakdown of the input format, the common output formats you can choose, and the core changes that happen during the conversion.

The Input: phylip Format

The phylip format is a simple, text-based format for multiple sequence alignments. It starts with a header line specifying the number of sequences and their length, followed by the sequence names (often in a fixed-width column) and the sequence data.

Example phylip file:

 5 38
Cow        ATGGCATATCCCTCGCTCTGACCACATCCAAAC
Carp       ATGGCACACCCCCAGCTCTGACCACATCCAAAC
Chicken    ATGGCCAACCCCAGCCCTGACCACATCCAAAC
Human      ATGGCACACCCCTCGCTCTGACCACATCCAAAC
Loach      ATGGCACACCCCCAGCTCTGACCACATCCAAAC

Common Output Formats & Their Uses

Your choice of output format depends on the software or analysis you plan to use next.

• fasta Format: This is the most universal format in bioinformatics. Each sequence begins with a single-line description header (starting with >), followed by the raw sequence data on subsequent lines.
  • Best for: General sequence analysis, submission to online databases (like BLAST), and use in almost any alignment or viewing software.
• nexus Format: A highly structured, block-based format capable of storing alignments, phylogenetic trees, and metadata in a single file. Data is organized into blocks like DATA, TAXA, and TREES.
  • Best for: Advanced phylogenetic and evolutionary analyses using programs like MrBayes, BEAST, and PAUP*.
• clustal Format: The default output format for the Clustal family of alignment programs. It includes a header and displays the alignment in blocks, often with consensus symbols to indicate sequence conservation.
  • Best for: Viewing or editing alignments in software like Jalview or SeaView, and for compatibility with the Clustal software package.

The Core Transformation Process

Regardless of the output you select, the converter performs these fundamental steps:

1. Parses the phylip Header: It reads the first line to understand the dimensions of the alignment (number of sequences and length).
2. Extracts Sequence Data: It separates each sequence name from its corresponding sequence string.
3. Applies New Formatting Rules: It rebuilds the file according to the syntax of your chosen output format—whether that means adding > headers for fasta, creating BEGIN/END blocks for nexus, or arranging the data in the clustal alignment style.

Compatible Software

The generated output files can be used with hundreds of bioinformatics tools. The ideal software depends on your chosen format:

• fasta files: BLAST, Clustal Omega, T-Coffee, MEGA, and most sequence analysis tools.
• nexus files: MrBayes, BEAST, PAUP*, FigTree, Mesquite.
• clustal files: ClustalX/ClustalW, Jalview, SeaView, MEGA.

Troubleshooting Guide

Encountering an error can be frustrating, but most issues are easy to fix. Here are the most common problems you might face and how to resolve them.

General Tool Errors

Error: “File size exceeds the limit”

• Why it happens: Your uploaded file is larger than the maximum allowed size (25 MB). Our server has this limit to ensure quick processing for all users.
• How to fix: For very large alignments, consider splitting your dataset if appropriate. For processing larger files, please contact us for custom solutions.

Error: “Processing timed out”

• Why it happens: The conversion is taking too long, which can occasionally happen with exceptionally large files.
• How to fix: Please try uploading the file again. If the issue persists, verify that your file format is correct. If the file is valid and continues to time out, please contact us to discuss options.

Error: “CAPTCHA validation failed”

• Why it happens: Our system uses a CAPTCHA to prevent automated bots. This error occurs if the CAPTCHA was not solved correctly or timed out.
• How to fix: Simply reload the page and solve the new CAPTCHA. If you continue to have trouble after reloading, please get in touch with our support team.

Conversion-Specific Errors

These errors typically relate to the formatting of the data within your phylip file.

Error: “Header missing or invalid”

• Why it happens: Your phylip file is missing the required first line that specifies the number of sequences and the alignment length (e.g., 5 38), or the numbers on that line are not integers.
• How to fix: Ensure your file begins with a valid header line containing two numbers separated by a space: the sequence count and the sequence length.

Error: “Mismatched sequence count or length”

• Why it happens: The numbers in the header line do not match the actual number of sequences or the length of the aligned sequences found in the file. Parsers are strict about this.
• How to fix: Open your phylip file in a text editor. Manually count the number of sequences and the number of characters in each sequence. Correct the two numbers on the first line to reflect the file’s contents accurately.

Error: “Inconsistent sequence lengths”

• Why it happens: The sequences in your alignment are not all the same length. The phylip format requires a true multiple sequence alignment where all sequences have equal characters (including gaps).
• How to fix: Re-open your alignment in an alignment editor (like MEGA or Jalview) and ensure all sequences are aligned and padded with gap characters (-) to be the same length. Export the corrected alignment and try again.

If your problem isn’t listed here, we want to know about it! Please help us improve the tool by reporting the issue.

Support Our Work

We are committed to keeping our scientific tools free and accessible for everyone. If this tool has been helpful in your work, please consider supporting our mission with a donation. Your support directly helps us cover server costs and fund the development of new, powerful tools for the scientific community.

FAQ

References & Suggested Reading

This tool operates according to the well-defined standards for common bioinformatics file formats. The resources listed below are foundational papers for these formats and the underlying software principles.

1. Pearson, W. R., & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences, 85(8), 2444–2448. https://doi.org/10.1073/pnas.85.8.2444
2. Maddison, D. R., Swofford, D. L., & Maddison, W. P. (1997). NEXUS: an extensible file format for systematic information. Systematic Biology, 46(4), 590–621. https://doi.org/10.1093/sysbio/46.4.590
3. Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22(22), 4673–4680. https://doi.org/10.1093/nar/22.22.4673