SRA to FASTQ Converter

Our SRA to FASTQ Converter is a web tool designed for bioinformaticians and researchers who work with next-generation sequencing (NGS) data. It quickly converts compressed SRA files into the widely used FASTQ format. The tool extracts the raw sequence reads and their associated quality scores from the SRA archive, making the data readable and ready for analysis. This conversion is the critical first step for downstream applications such as quality control, read mapping, or genome assembly.

How to Use (Step-by-Step)

Follow these simple steps to convert your sra data to fastq format.

1. Upload Your Data File: Click “Click to upload” or drag and drop your .sra file directly into the designated area.
2. Select Input and Output Formats: The “Input Format” dropdown will automatically show SRA. From the “Output Format” dropdown, select FASTQ.
3. Start the Conversion: Click the “Convert File” button to begin the conversion.
4. Download Your File: Once the conversion is complete, your new fastq file will download automatically.

Input, Output, and Key Changes

Understanding the transformation from the SRA archive format to the FastQ text format is key to any sequencing analysis. Here’s a breakdown of the formats and the changes that occur in each.

Sample Input (SRA Format)

The Sequence Read Archive (sra) format is a binary, compressed archive format used by the National Center for Biotechnology Information (NCBI) to store raw, high-throughput sequencing data. It is not human-readable. It efficiently bundles sequence reads, quality scores, and experimental metadata into a single file, but it cannot be used directly by most alignment or analysis tools.

Sample Output (fastq Format)

The fastq format is the universal standard for storing sequencing reads and their corresponding quality scores. It is a text-based format that uses four lines per sequence read. This format is the required input for virtually all NGS analysis tools.

Example of a single read in a fastq file:

@SRR123456.1.1 1 length=101NTGCAACGCTATGCATTGATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC+!AAFFJJJ<FJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

Key Changes in the Conversion Process

The conversion from sra to fastq is primarily a process of decompression and reformatting:

• Data Decompression: The tool unpacks the highly compressed binary sra file (or a gzip compressed version) to access the raw sequence and quality data stored within.
• Reformatting to 4-Line Structure: The core change is the organization of this data into the standard four-line fastq format:
  1. Line 1: Sequence identifier (starts with @).
  2. Line 2: The raw nucleotide sequence.
  3. Line 3: A separator line (starts with +).
  4. Line 4: The ASCII-encoded quality scores for the sequence in line 2.

Compatible Software

The generated fastq files are the standard starting point for almost all next-generation sequencing analysis pipelines and software, including:

• Quality Control: FastQC, MultiQC
• Read Trimming: Trimmomatic, Cutadapt
• Read Alignment/Mapping: BWA, Bowtie2, STAR, HISAT2
• Genome Assembly: SPAdes, Velvet, ABySS
• Microbiome Analysis: QIIME 2, mothur

Troubleshooting Guide

Encountering an error can be frustrating, but most issues are easy to fix. Here are the most common problems you might face and how to resolve them.

Error: “Invalid or corrupt SRA file”

• Why it happens: The file you uploaded is not a valid SRA archive. It may have been corrupted during download, is an incomplete file, or is in a different format altogether.
• How to fix: Re-download the .sra file from its source and try uploading it again. Verify the file’s integrity (e.g., check its MD5 checksum if available) before uploading.

Error: “Empty SRA file”

• Why it happens: The uploaded .sra file is valid but contains no sequence reads. This can sometimes happen with test files or failed sequencing runs.
• How to fix: Check the origin of your file. If you expect it to contain data, you may need to re-acquire it from the source database or experiment.

Error: “Unsupported SRA format version”

• Why it happens: The .sra file was generated with a very old or a new, unsupported version of the SRA-Toolkit, and our backend engine cannot parse it.
• How to fix: Try to identify the source and toolkit version of the file. If it’s a known-good file, please report the issue to us so we can investigate compatibility.

Error: “File size exceeds the limit”

• Why it happens: Your uploaded .sra or .gz file is larger than our server’s maximum allowed size of 100 MB.
• How to fix: This web tool is designed for convenience and smaller files. For larger, full-scale experimental files, the standard approach is to use the command-line SRA-Toolkit. We have a helpful guide on how to install and use the SRA-Toolkit which is ideal for this purpose. For other custom web solutions, please contact us.

If your problem isn’t listed here, we want to know about it! Please help us improve the tool by reporting the issue.

Support Our Work

We are committed to keeping our scientific tools free and accessible for everyone. If this tool has been helpful in your work, please consider supporting our mission with a donation. Your support directly helps us cover server costs and fund the development of new, powerful tools for the scientific community.

FAQ

References & Suggested Reading

1. Li, Y., Kanz, C., & Ruan, J. (2021). The Sequence Read Archive: A decade of data representation and support. Nucleic Acids Research, 49(D1), D298–D302. https://doi.org/10.1093/nar/gkaa1050
2. Cock, P. J. A., Fields, C. J., Goto, N., Heuer, M. L., & Rice, P. M. (2010). The Sanger fastq file format for sequences with quality scores, and the Solexa/Illumina fastq variants. Nucleic Acids Research, 38(6), 1767–1771. https://doi.org/10.1093/nar/gkp1137
3. Leinonen, R., Sugawara, H., & Shumway, M. (2011). The Sequence Read Archive. Nucleic Acids Research, 39(Database issue), D19–D21. https://doi.org/10.1093/nar/gkq1019